Symposium on Biological Information at Cornell

[Jorge]

The last example of this I'm familar with was at SMU. At that "conference", they rented space the school rents out to non-school-related events of all kinds. And like Jorge here, they were careful to say the event was held AT SMU, with the implication that it was held BY SMU. So it should be noted that neither SMU nor Cornell has sponsored these events, the school didn't invite anyone, the school does not endorse anything anyone says. They only rented out an auditorium.

Next, at SMU, they advertised the fact that numerous evolutionary biologists were invited to give presentations. They carefully didn't mention that none of them showed up. Then they implied that actual published (or accepted to be published) research papers were presented by these noted scientists. But of course, it was only creationists preaching at one another and trying to do all they could to create the false impression that SMU's reputation was somehow at stake.

Now, one of the purposes of REAL scientific conferences (there are several purposes) is for lesser-known researchers to make names for themselves by presenting interesting work. The very LAST thing they would do would be to request that their name be withheld.

Moving right along, "biological information" remains undefined. And this is essential to the creationist approach, because one can ponitificate about not finding something, without somehow remembering to mention that what wasn't found isn't defined. What we have here is the quintessential foregone conclusion. And sometimes it takes a careful eye to notice that this "graduate student in evolutionary biology" is not named, nor is the school where he is presumably studying. What interesting omissions. So we don't know the names of the presenters, we don't know where they are going to school, we can't track any of them down, we can't read their papers, and we deliberately are not told where we might someday find them, nor when exactly. At real science conferences, each attendee is handed as many copies of each paper as he wants. These are explicitly public documents.

But of course, the purpose of this "conference" wasn't to DO science, or PRESENT science, or DEBATE RESULTS. It was to to create the false impression that ID is a healthy field of research recognized as such by Cornell (and SMU). An impression being created by unnamed people, investigating undefined terms, in unavailable papers. I wonder how many times the creationists will try this before they decide the return per PR dollar isn't quite enough anymore.

***********************************************************************

[sigh ...]

I'll only give here the response that is deserved :

Yes, many faculty members, administrators and students from Cornell were invited.
Yes, only TWO students showed up (no faculty, no administrators).
We still had about 120 in attendance.

Yet, you will not see a more scientific symposium anywhere - it was pure science
where no philosophical or religious digressions were allowed.

It was sad, very sad to see the response to the invitations. We all agreed that
one and only one thing could explain such a reaction : F - E - A - R. Actually
we later recognized a second - commitment to an ideological position (certainly
not science).

There was nothing new in that for me since, as most of you know, I have been
playing that song here at TWeb from the first day I arrived. Nonetheless, I was
literally floored to see this happening in the flesh. Here is one of the "Ivy League
Towers" of learning -- where knowledge is supposed to rule the day -- and these
learned PhD-clad people would not even show up to listen. Yet, rest assured
that they will publish their criticisms (about stuff that they have NOT listened to).

But there was something far worse, far sadder. Many of the people there had
to state that they were "undercover" -- we could not post pictures/videos on
public sites for fear of reprisals. One of the attendees (name withheld here,
of course), is presently involved in legal actions for being fired from his/her
job (I'm concealing even the gender of said individual) from a US National
Laboratory. Why was s(he) fired? For promoting ID on his/her time and
expense!!! Similar stories of thought-police actions were repeated by
several individuals at this conference - it was SICKENING!!

Believe whatever you wish but this is as real as it gets. I like to see the
silver lining in all things. Here the silver lining is that the ONLY way a
loser can "win" is by completely silencing the opposition. Better yet, if
they can make it so that their opposition does not even get a hearing then
they "win" by default. THAT is what Materialists/Evolutionists have been
reduced to doing - total censorship

Deep inside they know that they do not stand a chance if it's a fair fight
with both sides being given equal opportunity to present their case.
And so they have to tip the scales -- they have to do this and that is what
they do. In my eyes, that is a good thing. When your opponent has
been reduced to that level of action you know that they have nothing
to stand on except false beliefs. Otherwise, why be so afraid?

Okay, 'nuff said. Now go away, Phank.

Jorge

[wattsr1]

Yet, you will not see a more scientific symposium anywhere - it was pure science
where no philosophical or religious digressions were allowed.

Yes but it was not really "pure science" was it Jorge? It was "pure science" so called?

Unlike making toasters, fast cars, and better toothpaste, your pure science was not metaphysically inert?

Or was it metaphysically inert?



Regards, Roland

[Ansgar Seraph]

No, it does not. Let me offer an example: consider the word 'cat'. You have three letters c-a-t.
Do those three letters resemble in any way a mammal that purrs and meows and everything else
that people love and hate about cats? Nope - not in any way. If you spoke and read ONLY
Hebrew and saw CAT you would not in any way "see" a cat. Yet, if I showed you a picture of a
cat then in ANY language you would "see" a cat because the image resembles the actual entity.

That is what we mean by an abstract code -- the code does not resemble the entity being represented.

But that's the problem, isn't it? DNA isn't like the word "cat." The Roman alphabet is completely arbitrary and a particular animal can be just as accurately described as "cat," "chat," "猫" or any other arbitrary bit of code. That same animal, however, cannot be described by arbitrary DNA. It is not, therefore, an abstract representation. It feels like Gitt makes the mistake of believing that DNA is somehow distinct from the person standing in front of him.

You are confusing things. A naturally-occurring electrical pulse is not UI but we can certainly
manipulate this pulse in such a way as to encode it in, say, Morse Code - now it would be UI.

The electromagnetic radiation that we receive from a star (or a pulsar) is just EM radiation - period.
But this same radiation could be manipulated into UI. There is no issue here.

The point is that one cannot know if some intelligent "sender" is manipulating physical phenomena into UI. Maybe every pulsar contains UI and we're just unable to recognize it. Maybe the sun's machinery is UI and we just don't know it yet. Virtually anything could be UI under Gitt's definition because there's no way to objectively quantify semantics, pragmatics or purpose. I see that as a problem because it cuts both ways; if it's possible for any physical process to be UI, it is also possible for a receiver to mistake any given process as UI without warranted cause.

In the book we actually propose (a rough) approach to quantifying semantics, pragmatics
and apobetics. I expressed mixed feelings about this - it's not an easy issue. For one
thing, NOT everything that is real is necessarily quantifiable. To wit: how many "units" of
love do you have for your spouse or children? Yet, would you deny that this love is real?

There is also a subjective element. I'm not giving up just yet but there do seem to be
aspects here that are beyond mere superficial quantification.

Five units. But they're BIG units.

I agree that the issue of quantification is an issue; I see it as a real problem for the scientific determination of UI.

—Sam

[wattsr1]

But that's the problem, isn't it? DNA isn't like the word "cat." The Roman alphabet is completely arbitrary and a particular animal can be just as accurately described as "cat," "chat," "猫" or any other arbitrary bit of code. That same animal, however, cannot be described by arbitrary DNA. It is not, therefore, an abstract representation. It feels like Gitt makes the mistake of believing that DNA is somehow distinct from the person standing in front of him.





The point is that one cannot know if some intelligent "sender" is manipulating physical phenomena into UI. Maybe every pulsar contains UI and we're just unable to recognize it. Maybe the sun's machinery is UI and we just don't know it yet. Virtually anything could be UI under Gitt's definition because there's no way to objectively quantify semantics, pragmatics or purpose. I see that as a problem because it cuts both ways; if it's possible for any physical process to be UI, it is also possible for a receiver to mistake any given process as UI without warranted cause.




Five units. But they're BIG units.

I agree that the issue of quantification is an issue; I see it as a real problem for the scientific determination of UI.

—Sam

I guess if DNA is a code being sent by an ID then presumably it has a message. I wonder what the message is and what receiver it is being sent to? And can the receiver understand the message enough to write another message with the same code and return it to the original sender?

I think that is how codes normally work.

Perhaps that's what original sin is. DNA got the message but could not quite understand how it was to behave properly, and it did not know how to send the message back, asking for clarification. Design flaw I reckon. :)



Regards, Roland

[Jorge]

Yes but it was not really "pure science" was it Jorge? It was "pure science" so called?

Unlike making toasters, fast cars, and better toothpaste, your pure science was not metaphysically inert?

Or was it metaphysically inert?

Regards, Roland

**************************************************************

Tell me the truth, you actually get paid for torturing me, right?

Jorge

[wattsr1]

**************************************************************

Tell me the truth, you actually get paid for torturing me, right?

Jorge

So you are shifting your stance on this Jorge? Was the "pure science" metaphysically inert or not. It's your term, not mine. I'm just applying it in the same manner you do.


Regards, Roland

[wattsr1]

So you are shifting your stance on this Jorge? Was the "pure science" metaphysically inert or not. It's your term, not mine. I'm just applying it in the same manner you do.


Regards, Roland

IIRC it went as follows - ToE is not true science because it is not metaphysically inert because it has philosophical/theological underpinnings. This is even so when ToE is defined only in terms of genetics and hereditary.

However, here you are, telling us about a conference you were at, a conference on information, but with an ID underpinning it would seem, and the science was "pure science".


How can this be so?




Regards, Roland

[Jorge]

But that's the problem, isn't it? DNA isn't like the word "cat." The Roman alphabet is completely arbitrary and a particular animal can be just as accurately described as "cat," "chat," "猫" or any other arbitrary bit of code. That same animal, however, cannot be described by arbitrary DNA. It is not, therefore, an abstract representation. It feels like Gitt makes the mistake of believing that DNA is somehow distinct from the person standing in front of him.

Huh??? Did you miss the point in my example?

Let me try once again : cosyntics is about an ABSTRACT representation. DNA that codes
for proteins is indeed exactly like 'cat' --- e.g., AGATCAATTTAGGATATCCC... etc. is a coded
message that only after "comprehended" does it lead to the actual entity - a specific protein.
Before that it is nothing that resembles the actual entity (the protein) in any way.

Likewise, 'cat' is a coded message that only after "comprehended" does it lead to you or
anyone else "seeing" a furry mammal that purrs and meows.

It can't be any clearer, AS --- don't look to make this harder than it is.

The point is that one cannot know if some intelligent "sender" is manipulating physical phenomena into UI. Maybe every pulsar contains UI and we're just unable to recognize it. Maybe the sun's machinery is UI and we just don't know it yet. Virtually anything could be UI under Gitt's definition because there's no way to objectively quantify semantics, pragmatics or purpose. I see that as a problem because it cuts both ways; if it's possible for any physical process to be UI, it is also possible for a receiver to mistake any given process as UI without warranted cause.

Not true. One aspect of UI that we did not dwell upon too much (for various reasons) is the
statistical aspect. There is always a probability of Type I and Type II statistical errors (which
is what you are talking about). But complexity issues negate that. You are also not taking
into account the important aspect of context. 'YES' has a probability of being randomly generated
but in the context of a man kneeling in front of a woman and asking her, "Will you marry me?"
the 'YES' has a very specific meaning. The same applies to far more complex signals.
Dembski treats this under the concept of a "specification". I pointed out to Gitt and Compton
that Dembski's specification concept 'embodies' semantics, pragmatics and apobetics.
IOW, we 'unpack' what a specification contains.

Five units. But they're BIG units.

Cute but I hope you're beginning to get the point.

I agree that the issue of quantification is an issue; I see it as a real problem for the scientific determination of UI.

It may not be an issue at all - this remains to be seen. OTOH, if you belong to the school that
unless things are quantified then they are not 'real' or 'scientific' then it could indeed be a major
problem - maybe even a show-stopper. But that would be as a result of the erroneous belief
of 'quantification is essential'. It is NOT essential, as your love for spouse and children proves.

Jorge

[oxmixmudd]

Questions, anyone?

I must state this up front : I will not be able to answer all questions on account of the
most disturbing (and disgusting!) thing that I learned at this conference.

That said, I will answer whatever I am able.

The Symposium was, in a word, outstanding! Superb science being carried out
with results that, sadly (hehe) do nothing to promote Darwinism. One of the
presenters (name withheld upon request) is a Darwinist and even he admitted this.
I was surprised that he didn't convert right then and there but I guess that would
have been too much to ask -- akin to Tiggy becoming a Biblical Creationist.

To start things off: one of the papers was by a graduate student in Evolutionary
Biology. He used the program Avida to see if he could get a net gain in information
using every realistic combination of parameters that he could construct. He began
his presentation by noting that the ONLY way to get any information "gain" was
by using biologically unrealistic parameter settings, in particular with regard to
the "selection" settings. His conclusion was that under any biologically relevant
conditions, there will always be a net loss of genetic information. He compared
Avida with Mendel's Accountant under the same parameter settings and obtained
essentially the same results.

The Proceedings (including his paper) should be published in 2-4 months.
The publisher is highly reputable and secular [I will let you know in due time].

To me this work / paper only provided further confirmation of something that I
have long known. It was, nonetheless, excellently done.

Jorge

Real science is required to be submitted for critical analysis. Until you are willing to discuss the paper in specific (how information change was measured, the parameters used etc etc), you have nothing more than a random claim unsupported by the evidence.

To the issue of information: It is critical that two things be established. The first is that whatever it is being measured as 'information' has some significant bearing on the mechanism of evolution, specifically the capability of a population to evolve over time. The second applies only if the first is in fact valid, and that is whether all parameters under which 'new information' was measured are indeed outside that expected in a real biological system.

And I will again add that all claims of the impossibility of man flying are rendered invalid upon the first successful manned flight. The fact we have a >500 million year history recorded in the sediments of life changing and evolving tends to make claims like the ones you are making intrinsically moot. Life did evolve. The question is how, not if.


Jim

[oxmixmudd]

Huh??? Did you miss the point in my example?

Let me try once again : cosyntics is about an ABSTRACT representation. DNA that codes
for proteins is indeed exactly like 'cat' --- e.g., AGATCAATTTAGGATATCCC... etc. is a coded
message that only after "comprehended" does it lead to the actual entity - a specific protein.
Before that it is nothing that resembles the actual entity (the protein) in any way.

Likewise, 'cat' is a coded message that only after "comprehended" does it lead to you or
anyone else "seeing" a furry mammal that purrs and meows.

It can't be any clearer, AS --- don't look to make this harder than it is.

BUT AGATCAATTTAGGATATCCC is NOT a DNA sequence. It is an abstract representation of a specific DNA molecule. The actual DNA molecule it represents is a chemical that in the right environment may produce a protein. It (the DNA molecule) is not a 'code' that needs to be 'comprehended', nor does it need a 'comprehendor'. It is a complex molecule that has certain physical characteristics and that will react in a certain way in a certain environment. WE can conceptualize it as a code. We can conceptualize its reaction as 'comprehension of the code'. But these too are abstractions imposed by us upon the physical reality. The fact we can conceive of the molecule in this way does not by itself imply DNA is in fact a 'code' in the sense it was 'designed' (and by designed I mean put together for the first time by intelligent forces or or outside this cosmos). It may well be that is it simply a naturally occurring artifact of the inherent properties of the universe (which one can then attribute to divine design).

[Tiggy]

No, it does not. Let me offer an example: consider the word 'cat'. You have three letters c-a-t. Do those three letters resemble in any way a mammal that purrs and meows and everything else that people love and hate about cats? Nope - not in any way. If you spoke and read ONLY Hebrew and saw CAT you would not in any way "see" a cat. Yet, if I showed you a picture of a cat then in ANY language you would "see" a cat because the image resembles the actual entity.

That is what we mean by an abstract code -- the code does not resemble the entity being represented. We identify another type of information (not UI) that we call MII - Mental Image Information. MII does not have an explicit code and syntax (cosyntics) as does UI. Anyway, lots more ...

LOL! So you made up your own definition of the term abstract different than what the rest of the world uses. You made up yet another vague undefined subjective meaning for information. You are still equivocating over the different meanings of code. Man, you guys really were burning the midnight oil.

This must not be abstract information by your new definition, right?


- T

[Tiggy]

BUT AGATCAATTTAGGATATCCC is NOT a DNA sequence. It is an abstract representation of a specific DNA molecule. The actual DNA molecule it represents is a chemical that in the right environment may produce a protein. It (the DNA molecule) is not a 'code' that needs to be 'comprehended', nor does it need a 'comprehendor'. It is a complex molecule that has certain physical characteristics and that will react in a certain way in a certain environment. WE can conceptualize it as a code. We can conceptualize its reaction as 'comprehension of the code'. But these too are abstractions imposed by us upon the physical reality. The fact we can conceive of the molecule in this way does not by itself imply DNA is in fact a 'code' in the sense it was 'designed' (and by designed I mean put together for the first time by intelligent forces or or outside this cosmos). It may well be that is it simply a naturally occurring artifact of the inherent properties of the universe (which one can then attribute to divine design).

Yep. Looks like Jorge and Gitt are still riding the same old equivocation train over the meaning of code. 'Code' as used by geneticists when referring to DNA only means a process where specific inputs map to specific outputs.

Sorry Jorge, no matter how many times you assert it, DNA is not an ABSTRACT code. It does not contain or pass any ABSTRACT information.

You can bluster all day about how natural processes don't create new ABSTRACT information and it won't matter one bit because natural processes don't use ABSTRACT information to begin with.

-T

[phank]

***********************************************************************

[sigh ...]

I'll only give here the response that is deserved :

Well, do what you can, OK?

Yes, many faculty members, administrators and students from Cornell were invited.
Yes, only TWO students showed up (no faculty, no administrators).
We still had about 120 in attendance.

And this tells us what? As I said, part of the PR effort is to invite qualified people, knowing they will ignore you. THEN you can claim they were invited, so it sounds legitimate. But in fact, the only people who showed up were creationists and probably some curious bystanders. No qualified people whatsoever. As usual.

Yet, you will not see a more scientific symposium anywhere - it was pure science
where no philosophical or religious digressions were allowed.

Except, of course, your definition of "biological information" as "something evolution can't produce" is not only totally unscientific, but purely theological. After all, the concept isn't defined, except negatively in theological terms. You have no science.

It was sad, very sad to see the response to the invitations. We all agreed that
one and only one thing could explain such a reaction : F - E - A - R. Actually
we later recognized a second - commitment to an ideological position (certainly
not science).

Well, there actually IS a third possibility - that scientists generally are too busy to attend theological conferences pretending to be scientific, in order to create misleading PR. And quite possibly, your charade is being ignored because it's ridiculous.

There was nothing new in that for me since, as most of you know, I have been
playing that song here at TWeb from the first day I arrived. Nonetheless, I was
literally floored to see this happening in the flesh.

You mean, producing a sham and then trying to figure out why qualified people ignored it? Yes, I can see how this would amaze you. After all, a sham is all you have; it's your entire purpose in life.

Here is one of the "Ivy League
Towers" of learning -- where knowledge is supposed to rule the day -- and these
learned PhD-clad people would not even show up to listen. Yet, rest assured
that they will publish their criticisms (about stuff that they have NOT listened to).

Not likely. Instead, they will continue to ignore you unless and until you do some actual science. Just because you keep repeating the same lies for years on end, doesn't make them come true. Honest and qualified people know this - and also know that you will NEVER learn.

Oh, and Cornell was not involved in this charade in any way. So quit trying to pretend they were. If you'd held a conference on REAL SCIENCE, with real peer-reviewed published material ready to present and defend, you could have held the conference in Podunk and qualified scientists would have accepted your invitations and attended. They have no desire to have lies preached at them.

But there was something far worse, far sadder. Many of the people there had
to state that they were "undercover" -- we could not post pictures/videos on
public sites for fear of reprisals.

Hilarious. If you had any REAL SCIENCE, people would strive to have their names and accomplishments published. It really ought to tell you something, that some of your people do not wish to be tarred with your lies.

One of the attendees (name withheld here,
of course), is presently involved in legal actions for being fired from his/her
job (I'm concealing even the gender of said individual) from a US National
Laboratory. Why was s(he) fired? For promoting ID on his/her time and
expense!!! Similar stories of thought-police actions were repeated by
several individuals at this conference - it was SICKENING!!

Yes, we have heard all that before. All these people "fired for wrong beliefs", until the facts come out, and it turns out their beliefs had absolutely nothing to do with it. Never have, never will. This again is nothing but PR, composed of lies, in order to create a false impression. How many times will you repeat these claims before you give up (and of course, since an investigation into the actual facts ALWAYS shows you're lying, of course you must conceal any details that would enable anyone to investigate. How very convenient.)

whatever you wish but this is as real as it gets.

Sadly, you are correct. It's fakery, lies, and misinformation inside and out, through and through, top to bottom, and that's as real as it gets.

to see the
silver lining in all things. Here the silver lining is that the ONLY way a
loser can "win" is by completely silencing the opposition.

Like holding a nice silent conference nobody interfered with, and renting space from Cornell that they were glad to rent out, and publicly inviting lots of people nobody prevented you from inviting, and presenting materials nobody stopped you from presenting, and then publishing and publicizing all of this and nobody interfered in any way. Yep, you sure were silenced. Or, maybe, you are LYING about being silenced? Imagine that!

yet, if
they can make it so that their opposition does not even get a hearing then
they "win" by default. THAT is what Materialists/Evolutionists have been
reduced to doing - total censorship

And your conference wasn't a hearing? You got to present materials despite "total censorship", AND publish them, AND publicize them? You are posting here for all to see, and nobody is stopping you in any way? And incidentally, there are plenty of qualified scientific journals out there that would be delighted to publish Avida-based material, after appropriate peer review. So if you can point to any censorship, please do. You have ALREADY pointed to lots and lots of non-censorship.

Deep inside they know that they do not stand a chance if it's a fair fight
with both sides being given equal opportunity to present their case.

And what was unfair here? you presented your conference, you're publishing your papers. The scientific journals are there if you can pass peer-review (which everyone must pass, of course, and much real science does not.)

And so they have to tip the scales -- they have to do this and that is what
they do. In my eyes, that is a good thing. When your opponent has
been reduced to that level of action you know that they have nothing
to stand on except false beliefs. Otherwise, why be so afraid?

Jorge, nobody is afraid of you. Qualified people are ignoring you because they have better things to do. Your charade is recognized for what it is, and here you are beating on the PR message it was fabricated to generate, like a good little creationist.

If I held a conference on how the moon is made of green cheese, and rented a room at Harvard, and invited 100 noted astronomers, and presented BS doctrine straight out of the Green-Cheesiology Bible, who would be astonished if none of those astronomers showed up. And THEN I could claim that nobody at Harvard cared about "knowledge", and that I am being "censored", and that they are "not playing fair", and that this was "real science" that's as "real as it gets". And I could allude to lots of unnamed green-cheesers losing their jobs for their faiths (but I can't give you enough information for you to actually check to see if I'm making this up). And all I would accomplish would be too look like a damn fool. AND YET, I could probably make a stronger case for the cheese moon than you can about anything biological.

[Tiggy]

Deep inside they know that they do not stand a chance if it's a fair fight
with both sides being given equal opportunity to present their case.

(cough cough) Kitzmiller v. Dover.

- T

[phank]

(cough cough) Kitzmiller v. Dover.

- T

Note that Dembski and others agreed to participate, and took the money paid to the participants (by the Discovery Institute), and then backed out. Which is just one of countless indications that the LAST thing creationists want is fairness. They want power. In fair fights (not just Dover, but Edwards and other cases in Ohio, Alabama, Kansas, Georgia, etc.) they have lost EVERY TIME. And always for the same reason - their religion is simply not science. I guess in creationist-speak, "fair" means "we get to stack the deck."