MECHANISM IN EVOLUTION

1. INTRODUCTION

With developments in our ability to analyze and decode the genome of organisms, it has been possible to ask questions about the mechanics of evolutionary change. It is one thing to collect evidence which demonstrates the actuality of something (evolution in this case), but it is another thing to demonstrate how that something actually occurs or behaves (the process of evolution).

This essay describes one such process in the mechanism of evolution. It concerns the development of new information by the creation of a new gene from parts of two other genes. This was reported in a recent edition of the Proceedings of the National Academy of Sciences (PNAS) (1), and concerns the evolution of a gene found in anthropoid primates (humans, apes, and the Old and New World monkeys), but not found in other primates (e.g. the tarsier) and other animals (zebrafish, mouse, rat, dog, cow). The gene is called SETMAR, named after a gene called SET and a “jumping gene” called Hsmar.

In this story, the key role was played by things called “jumping genes” or “transposons” and our bodies contain billions of these.

I am passing it on as an example of mechanism in evolution, in the hope that some creationists may read and think, “wow, the mainstream is not as clueless as I thought. It can come up with evidence for its claims”. Others may simply find the essay interesting.

Hopefully it is not a confusing essay. It could be though. I certainly found the research confusing to read and hard to understand. No fault of the research report. It was simply a case of my lack of knowledge. However, in re-describing the research, I found my self having to use many terms which I was unfamiliar with and hence which the reader may find very foreign, thereby clouding an understanding. Accordingly I have included a lengthy description of terms. Hopefully I have conveyed the meaning of those terms correctly.

You dear reader may need a cup of coffee of two. I do not think I could have described it any simpler yet it talks about front ends of exons coupled with back ends of introns, opening up cryptic splice sites down stream and so on. Sorry. But by doing this, I am trying to convey an idea of the mechanics of how this happened, and the evidence which shows it.

In talking about mechanism, this essay is describing a series of events that are inferred to have happened over an 18 million year period, beginning some 58 million years ago. The data is, IMO good, and therefore the evidence for this story is sound.

This essay is my understanding of the article as I read it. It is in no way to be construed as the words of an expert in any of the fields of investigation reported here.


2. AN AXIOM

It is assumed that evolution, macro that is, really does occur.

Now it may seem a tad unreasonable to assume that macro evolution is reality. However, assumptions similar to this one occur all the time in science. Thus, if a scientist is going to investigate the mechanism or process behind something, then it is automatically assumed that the “something” really does exist. For example, if a scientist is going to investigate the mechanism by which stars fuse elements in their cores, then he or she must automatically assume that fusion reactions really do occur there.

So it is not unreasonable to assume, in this context, that macro evolution occurs. That macro evolution occurs is the subject of different research and evidence for its reality is described beautifully at reference (2).


3. CONCEPTS

This section is long because understanding the terminology helps understand what the researchers think happened.

A chimeric primate gene.

Sounds like “The Creature from The Black Lagoon” kind of stuff, doesn’t it? Well a chimera is a mythological creature made up parts of different animals – say a goat’s head on a lion’s body. In genetics, a chimera is real. It is a viable cell containing genes from different species. In this essay, it is one gene, made up from two different genes.

Transposons (“Jumping Genes”) (See attachment 1).

[attachment=1]

They are mobile genetic elements which can “hop” from one part of a chromosome to another part. There are several different types. Some transposons simply hop from one part to another. Others actually make copies of themselves and the copies hop to another part of the genome. Some transposons hop by first having themselves coded from their DNA into messenger RNA. The messenger RNA is then decoded back into the transposon DNA which then inserts itself somewhere else in the genome. Transposons can be simple or complex. Simple ones, have a gene which codes for a transposase, the protein that cuts the transposon from its DNA and cuts other DNA to allow the transposon to re-insert itself elsewhere. This gene is flanked at each end by what are called Inverted Terminal Repeats (ITR). Complex transposons consist of several genes flanked by ITRs. Some complex jumping genes have a center of several genes which are flanked by simple transposons which are flanked by ITRs.

Inverted Terminal Repeats (ITR)

A short set of bases flanking each end of a transposon. The sets comprise the same bases but each repeat is inverted with respect to the other repeat on the other flank:-

TTACGTAG…………..CTATGTAA (The central dots indicate the transposase gene of a simple transposon)
AATGCATC…………. GATACATT

If you look at the above carefully you will see that each end is upside down relative to the other end.

With the advent of genome decoding projects, there exist many data-bases chock-a-block full of sequences from many animals. Complex computer algorithms are employed to search for patterns similar to the above. Such patterns are indicative of jumping genes.

Genes, exons, introns

In complex animals such as us, genes are broken into parts – exons and introns. Exons are the parts of the gene which code for a protein. Introns are kind of spacers between exons. When a gene (DNA) is transcribed into messenger RNA, both exons and introns get transcribed. This produces immature messenger RNA. The introns are then quickly snipped out, leaving just the exons concatenated as mature messenger RNA. This mature messenger RNA then goes to get decoded into protein.

Stop codon

Obviously when a stretch of DNA is being read into messenger RNA, if nothing tells the process to stop then a humungous length of RNA will result. Each gene (or the last exon of a gene) has a stop codon. This is generally the three bases “TAG”. For example:-

Reading direction---->
AAGTACACCAGAAACTTAGTAGAAAGTACCC……
(stuff inside the gene) (stop) (stuff outside of the gene)

Open Reading Frame (ORF)

“ORF” is what a dog says. But in genetics it is different. If the above “stop” tag is removed, then the transcribing system that codes the DNA into RNA has nothing to tell it to stop at the end of the gene (or at the end of the gene’s last exon). So the system continues to read and read until it happens to come across a TAG somewhere down stream. Such DNA is then called an open reading frame.

Alu elements

These are particular family of transposons found in the genome of primates. Like simple transposons, they are short – about 300 base pairs long. They appear to have been duplicated over and over in the genome of primates and occupy at least 10% of the mass of the human genome.

Authentic and Cryptic splice sites.

Splice sites are places where DNA or RNA is cut. Splicing has to occur when introns are removed from immature messenger RNA (see “Genes, exons, introns). Various types of proteins recognize various cutting sites by the particular codes (or patterns of bases (A, T, G, C)) they contain. Specific proteins splice specific sites. One particular code will be recognized by one particular splicing protein. This code is called the “authentic splice site”. However, there are other codes which can also be recognized by a particular splicing protein. These are called the “cryptic splice sites”. The authentic site will always be used unless for some reason it becomes de-activated. Then a cryptic site will be used.

Donor and Acceptor splice site or 5’ and 3’ splice sites.

The “beginning” (the end where gene decoding starts – and it always starts from one end for all genes along a stretch of DNA) of a piece of DNA, is called the 5’ end. The other end is called the 3’ end. Consider a stretch of DNA made up of exon 1 followed by an intron followed by exon 2 (i.e exon1 – intron – exon2). We have two splice sites. The first is at the exon 1 / intron boundary. The second is at the intron / exon 2 boundary. The splice site at the first boundary is called the 5’ splice site. The splice site at the second boundary is called the 3’ splice site.

Reading direction --->
(5’ end)……..EXON1...(1)...INTRON…(2)....EXON2…(3’ end)

or more precisely in this context

(5’end)….. (5’ end of exon1) …. EXON1….(3’ end of exon1) … (1) …. (5’ end of intron) …. INTRON … (3’ end of intron) ….(2) … (5’ end of exon2) …EXON2 … (3’ end of exon2) ….(3’ end)

In the above, (1) and (2) mark the splice sites. The 5’ splice site is typically a partially conserved (the pattern of bases (As, Cs, Gs and Ts) does not change much over evolutionary time) set of 9 bases. The same kind of thing can be said for the 3’ splice site, that is, it is made up of a particular code that is partially conserved over evolutionary time.

That site which is the 3’ end of an intron and a 5’ end of an exon, is called the “Acceptor splice site”. In this case it will be splice site (2). The site which is the 3’ end of an exon and the 5’ end of an intron is called the “Donor splice site”. Proteins, called splicosomes bind to these sites and by various chemical gymnastics, flick out the intron and leave the 3’ end of exon1 fused to the 5’ end of exon2.

4. THE RATIONALE BEHIND THE STORY

The rationale for the interpretation of the data is very simple (although I have no doubt, is more complex in practice). It runs as follows:-

If geologic, fossil, molecular and physiological evidence show that anthropoid primates (Jorge, JohnMartin, Roland, GlennMorton, other monkeys, …) split from prosimian primates (ancestors of tarsier, galago) and these split from other placental animals (ancestors of rats, mouse, dog, moo-cow) and that these split from marsupials (ancestors of opossum) which split from other vertebrates (e.g. ancestors of modern fish), then a certain kind of reasoning can occur on comparing the genes of anthropoids with those of prosimians with those of other placental mammals (rat, mouse, dog, cow), with those of marsupials (opossum), with those of other vertebrates (e.g. fish).

If on comparing a particular gene of several anthropoid primates with that of prosimian primates and other placental animals, and it is found that the prosiminans and placentals have a piece of code in that gene, which the anthropoids do not, then it can be logically argued that the anthropoids actually lost that piece of code within that particular gene. Similarly, if it is seen that all primates have a piece of code in a gene that placentals lack (they have the gene but not the bit of code), then it can be logically argued that the primates gained that piece of code.

And so it goes.


5. NOW TO OUR STORY

The SETMAR gene was reported as a chimera when discovered in 1997. It is made up of genes encoding a SET domain protein properly fused with the coding region of a jumping gene from a family of genes called mariner transposons. The particular member of this family was a gene called Hsmar1 and the part of it that was properly fused with the SET coding gene, was the transposase-coding region called MAR. By “properly fused” I mean that the genetic transcribing mechanism could start at the beginning of the SET region and correctly read through the MAR region, before hitting a “stop”.

Involved in the creation of this chimera were the retention of the existing two SET exons and their intron and the creation of a new intron connecting the SET gene to the MAR transposase gene. (See attachment 2)

[attachment=2]

So if SETMAR was a chimera, then when and how did it come to be?

The authors showed that the SET gene in non-primate animals - mouse, rat, dog, cow, zebrafish and opossum - was orthologous with the SET part of the SETMAR gene in primates (that is, it was the same gene but on different species). The SET gene closely matched the SET part of SETMAR in both coding and gene structure. None of these SET genes were followed by Hsmar genes downstream. This was evidence that the SET region actually existed in the ancestral primate and that the MAR region was added later, during primate evolution.

But when was SETMAR born? The researchers sequenced the MAR region in eight primate species, finding that the Hsmar gene resided on seven of the species which included hominoids, Old World monkeys and New World monkeys. But it did not reside in the Tarsier. The first seven species are anthropoid primates. The tarsier is a prosimian primate. Thus Hsmar was formed after the prosimian and anthropods split but before the modern anthropods arose.

Further research showed that the MAR transposon was derived from a common ancestral Hsmar transposon.

Given that prosimian and anthropoid primates split between 40 and 58 million years ago, then the following scenario was offered by the authors. See attachment 3.

[attachment=3]


Roughly 58 million years ago, the Hsmar transposon jumped along the anthropod primate genome, to just downstream of the primate SET gene. The researchers noted that the old Hsmar code in all species studied, carried an Alu transposon inside the ITR on the upstream side. Given that all species carried this Alu insertion, then that particular jump must have happened to the genome of the common ancestor to all modern species, that is, in all species from which the modern anthropod primates came. And given that a functioning ITR is needed at both ends of the transposon for the Hsmar gene to jump, then the Alu insertion probably fixed the Hsmar, thus preventing it from jumping away.

So far we have the following:-

1) The SET gene hangs round in the ancestor of anthropoid primates “doing its own thing”.
2) An Hsmar transposon jumps along to settle just down stream of the SET.
3) Before it jumps away, another transposon Alu jumps in and fixes Hsmar.

Not much has been achieved yet, because the second exon of the SET has its stop codon in place. Hence, any transcribing system is going to hit this stop and thus stop, thereby only coding the SET gene.

However, potential exists.

So how did MAR, the coding region of Hsmar fuse to SET, and fuse in such a way that a sensible gene could result?

The researchers examined the downstream end (3’ end) of the second SET exon as well as code flanking that end. They examined this for the anthropoid primates , the prosimian primates and non primate mammals. What they found was the following:-

For anthropoids AAGTCGAACATCAGTT--------------
For prosimians ..…..……….T ..……C…..TAGACCATGG
For other mammals …..…C…….….G……TAGGACTAAG

Reading direction ---->

(The ‘.’ indicate base codes that match the code above. The ‘-‘ means code has been deleted.)

Notice that bolded part? It exists in the prosimians and the non-primate mammals, but it has been deleted, along with other code (27 base pairs to be exact) in the anthropoids. Why do I point it out? It is the stop code for the second exon of the SET gene. (Only the “T” is left in anthropoids). This meant that, after the prosimians and anthropoids split, the stop code in the ancestors to modern anthropoids was deleted and this deletion was passed on to all subsequent generations and new species of anthropoid, as they arose.

With the stop code removed, the genetic reading system now had an open reading frame. It could read on and on until it hit the next stop code which was obviously at the end, the downstream end (3’ end) of the Hsmar gene.

Great. How could any sensible protein be made of this?

Well probably not much of a sensible protein unless ….

What happened with the removal of the stop on that second exon of the SET gene was the activation of a cryptic splice site some 77 base pairs beyond the end of the SET gene. The scientists examined this region in mammals that lack the MAR, identifying probable cryptic splice sites very close to the end of the second SET exon, splice sites that had no useful function until the Hsmar gene jumped in near by. With the splice region at the Hsmar front end (the 5’ end), things were now in place for the formation of an intron between it and the second SET exon. That cryptic splice site became activated and the new intron was formed. And with the Hsmar stop codon in place, the transcribing system automatically had a closed reading frame.

Thus, what happened after Hsmar jumped in was the following:-

1) Stop code and a following chunk of DNA was removed in the genome of the evolving anthropoid primates. (The prosimian primates and other mammals did not undergo these genetic recombination mutations. They continued on in the “same old way”).
2) This opened up to use, of a splice site a short way down stream from the end of the existing second SET exon. That splice site had always been sitting there but was useless.
3) But with Hsmar now there with a splice site at its front, its upstream end, an intron was formed from just beyond the end of the second SET exon to the start of the Hsmar transoposon (that is, the MAR region of the transposon).

Therefore, during transcription, the reading system would go from the start of SET exon1, pick up the SET intron, pick up the extended SET exon2, pick up the newly formed intron which went from just beyond SET exon2 to the start of the MAR transposon, and finally pick up the MAR.

This immature messenger RNA would then have the two introns removed, leaving SETMAR. This messenger RNA, coding the SETMAR gene, would then go on to have its protein made.

6. WHAT DOES SETMAR DO?

The researchers are unsure. They know it is functional. Additional experiments demonstrated that it is a widely expressed gene. They know that SET is involved in helping chromatin (our chromosomes) operate properly. But what does MAR do (other than our washing and ironing)?

The transposase region of the transposon has two parts – a DNA binding region and a DNA cutting region. (This helps the transposon do its own cut and paste of itself, its modus operandi). When they looked closely at the transposon the researchers noted that the DNA binding region is not changing much at all, whereas the DNA cutting region is changing, relatively rapidly. It would seem that evolution has no interest in the cutting region so it is mutating and degrading. However, evolution does have an interest in retaining the binding region, relatively unchanged.

They noted that the human genome has many, many potential SETMAR binding sites and hypothesized that SETMAR behaves as SET except that it does things much more efficiently. Where as SET relies on other proteins to carry out its functions, SETMAR, by using MAR, is able to bind directly to the human genome, allowing the SET to do its thing, without needing those other proteins. That is while, SET works fine, SETMAR does it much better.

"Anything SET can do, with MAR it can do better" (Sung to the tune of "Anything you can do I can do better".)

7. CONCLUSION

Here I have presented my understanding of research carried out and reported at reference (1).

It provides direct evidence showing how a new gene could have evolved over some 18 million years, starting 58 million years ago. (The researchers note that this is a rapid evolution!)

It is important to note that this is an example of genome rearrangement. It is not a long, slow, gradual accumulation of undirected change through so-called random mutation. Rather chunks of genes moved around. The nearby alignment of two genes SET and Hsmar precipitated by a fortunate jump of Hsmar created a potential. From then on the removal of one chunk (the stop codon, say) opened up the possibility of another system being activated (an old cryptic splice site). In one swoop, this brought about the extension of an exon and the creation of a new intron. And providing that the extension of the exon did not bring about any damage to the resulting protein, then things continued to work.

This is an example of how science is most often done. Experiments are performed to gather evidence from which inferences are drawn about structures and processes. A logical and coherent argument is made, which relies on supporting data. That is, the above essay is reporting what is typical of any science, be it chemistry, physics, astronomy, zoology, medicine, meteorology, etc. There is nothing weird about this kind of inferential reasoning in evolutionary biology. It is used in all science.

It does not rely on the axiom - "God exists". And it certainly does not rely on the axiom "God does not exist".


Regards, Roland


8. REFERENCES

(1) Richard Cordaux, Swalpa Udit, Mark A. Batzer, and Cedric Feschotte. “Birth of a chimeric primate gene by capture of the transposase gene from a mobile element”, PNAS, 103(21), p 8101-8106.

(2) Theobald, Douglas L. "29+ Evidences Macroevolution: The Scientific Case for Common Descent." The Talk.Origins Archive. Vers. 2.83. 2004. 12 Jan, 2004 <http://www.talkorigins.org/faqs/comdesc/>

Good grief Roland,

Don't you realise that that post is too long for Jorge!!!!!

Neat post

Cheers

Originally posted by Splint

Good grief Roland,

Don't you realise that that post is too long for Jorge!!!!!

Neat post

Cheers

Yes, super post (as much as I have taken in of it so far. )

I like the way the development sequence sequence fits with both common descent and the details of how the molecular mechanics work. The assumption of common descent may be criticized by some, but if the work had had to start with a justification of that assumption, it would be rather silly, like a car designer having to justify why he chooses round wheels. For those who would want to question the assumption, they must recognise that any alternative explanation of the development of this gene could not be an ad hoc one, and would have to account for all the facts at least as well. It is the coherent meshing together of a wide range of facts and theories that makes this sort of work compelling.

Pearls to you Roland.

Originally posted by Barry Desborough

Yes, super post (as much as I have taken in of it so far. )

I like the way the development sequence sequence fits with both common descent and the details of how the molecular mechanics work. The assumption of common descent may be criticized by some, but if the work had had to start with a justification of that assumption, it would be rather silly, like a car designer having to justify why he chooses round wheels. For those who would want to question the assumption, they must recognise that any alternative explanation of the development of this gene could not be an ad hoc one, and would have to account for all the facts at least as well. It is the coherent meshing together of a wide range of facts and theories that makes this sort of work compelling.

Pearls to you Roland.

Gidday Barry,

Thankyou for your words, and those pearls.

It was an essay that kind of drove me to despair. I was typing it up last weekend and got to that point where the second SETMAR intron evolves, and realized that I did not understand what the article was saying. I thought I had understood it. So it became another week of reading, contemplating, researching and re-reading what was really only a small section of the PNAS article.

To someone knowledgeable in the field, 'cryptic splice site' would have meant one thing and one thing only, in the context of the article. To me it either meant nothing or it could have meant anything at all. So it took a lot of work to fathom out what it meant in the context of "how did that second intron" evolve.

When the penny finally dropped, the feeling was great. But then I kind of lost it again for a day or too, then it came back, and stuck. (Bludy old age I guess )

Your comment about "assuming common descent". I felt that it was important to put that in because many creationists seem to complain that we often "assume evolution to be true". And often we do. But this occurs in all sciences. Often a materials scientist will work, on the assumption that the atomic theory of matter is correct. A meteorlogist will work, assuming that gasses really are made of atoms. An astrophysicist will work, assuming that the theory of stellar structure is correct. Scientists always do this. Theories are tools which explain ideas, which tell us what ideas need testing, and they serve as frameworks for our research. That is, they can become axiomatic in their own right.

Creationists seem to think this is bad, yet scientist do this all the time, including scientists who are their own heroes. So their complaint is silly.

It's a bit like the complaint of "bias". Another well intentioned but silly creationist complaint. I tend to slap my forehead these days when a creationist lectures me about "bias". Some how, "bias" is a dirty word when used in the context of evolution, cosmology and ancient earth, yet it is over looked in physics, chemistry, atomic theory of matter, spherical earth, botany, zoology, 2LoT etc. etc.

So we have our creationists friends sitting in science lectures on physics, chemistry etc., listening to all these theories which are naturalistic and biased and they take it all in as they do the Bible. Then the words "evolution", or "ancient earth" are mentioned and up go the hands -

"'Xcuse me sir - bias, bias ,bias".

(And if Jorge is there listening, it is "'Xcuse me sir - Naturalism, Naturalism, Naturalism").

I mean it is just plain whacky.

If they have an argument, then they should apply it constistently or at least justify why it should not be applied consistently. (ARE YOU READING THIS OUT THERE FOLKS????. Sorry BD, just had to slip that one in, just in case a YEC or an IDer happens to read this.)


Regards, Roland